eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine

HOME
QUERY
- DISEASE
- GENOTYPE
NETWORK
- PHENOTYPE
- GENE
- COMMON
- DISEASE PAIR
DOWNLOAD
SUBMIT CASE
HELP&FAQ
- HELP&FAQ
- CONTACT US


	epilepsy, progressive myoclonic 1a

Disease ID	1652
Disease	epilepsy, progressive myoclonic 1a
Definition	An autosomal recessive condition characterized by recurrent myoclonic and generalized seizures, ATAXIA, slowly progressive intellectual deterioration, dysarthria, and intention tremor. Myoclonic seizures are severe and continuous, and tend to be triggered by movement, stress, and sensory stimuli. The age of onset is between 8 and 13 years, and the condition is relatively frequent in the Baltic region, especially Finland. (From Menkes, Textbook of Child Neurology, 5th ed, pp109-110)
Synonym	baltic myoclonic epilepsies baltic myoclonic epilepsy baltic myoclonus baltic myoclonus epilepsies baltic myoclonus epilepsy disease, unverricht disease, unverricht-lundborg diseases, unverricht diseases, unverricht-lundborg epilepsies, baltic myoclonic epilepsies, baltic myoclonus epilepsy, baltic myoclonic epilepsy, baltic myoclonus epilepsy, mediterranean myoclonic epilepsy, progressive myoclonic 1 epilepsy, progressive myoclonic type 1 epilepsy, progressive myoclonic, 1 epilepsy, progressive myoclonic, 1a epilepsy, progressive myoclonus 1 epm1 epm1a lundborg unverricht syndrome lundborg-unverricht disease lundborg-unverricht syndrome mediterranean myoclonic epilepsy myoclonic epilepsies, baltic myoclonic epilepsy of unverricht and lundborg myoclonic epilepsy, baltic myoclonic epilepsy, mediterranean myoclonus epilepsies, baltic myoclonus epilepsy, baltic myoclonus progressive epilepsy of unverricht and lundborg myoclonus, baltic pme progressive myoclonus epilepsy 1 progressive myoclonus epilepsybaltic myoclonic epilepsy syndrome, lundborg-unverricht syndrome, unverricht-lundborg uld unverricht - lundborg disease unverricht dis unverricht disease unverricht diseases unverricht lundborg disease unverricht lundborg syndrome unverricht syndrome unverricht's disease unverricht-lundborg disease unverricht-lundborg diseases unverricht-lundborg syndrome unverricht-lundborg syndrome (disorder) unverricht-lundborg syndrome [disease/finding] unverricht-lundborg-lafora disease
Orphanet	ORPHANET:308
OMIM	OMIM:254800
DOID	DOID:3535 DOID:891
UMLS	C0751785
MeSH	D020194
SNOMED-CT	SNOMEDCT_US_2016_09_01:230423006
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:4) C0751778 \| progressive myoclonus epilepsy \| 3 C0014544 \| epilepsy \| 2 C0014544 \| epileptic seizures \| 1 C0014544 \| epileptic seizure \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:3) 1476 \| CSTB \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT 950 \| SCARB2 \| ORPHANET 144165 \| PRICKLE1 \| ORPHANET;UNIPROT
Inferring Gene	(Waiting for update.)
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:28) 347 \| APOD \| 1.937 \| DISEASES 617 \| BCS1L \| 1.576 \| DISEASES 834 \| CASP1 \| 1.604 \| DISEASES 1137 \| CHRNA4 \| 1.83 \| DISEASES 1201 \| CLN3 \| 2.718 \| DISEASES 1203 \| CLN5 \| 2.113 \| DISEASES 1508 \| CTSB \| 2.094 \| DISEASES 1520 \| CTSS \| 2.831 \| DISEASES 1523 \| CUX1 \| 2.047 \| DISEASES 114327 \| EFHC1 \| 3.988 \| DISEASES 7957 \| EPM2A \| 3.976 \| DISEASES 2335 \| FN1 \| 1.221 \| DISEASES 2395 \| FXN \| 1.023 \| DISEASES 2741 \| GLRA1 \| 2.683 \| DISEASES 8349 \| HIST2H2BE \| 1.084 \| DISEASES 3736 \| KCNA1 \| 1.917 \| DISEASES 3785 \| KCNQ2 \| 1.487 \| DISEASES 3786 \| KCNQ3 \| 3.003 \| DISEASES 51734 \| MSRB1 \| 1.682 \| DISEASES 4566 \| MT-TK \| 4.338 \| DISEASES 4599 \| MX1 \| 1.06 \| DISEASES 378884 \| NHLRC1 \| 3.51 \| DISEASES 51400 \| PPME1 \| 3.161 \| DISEASES 56978 \| PRDM8 \| 3.743 \| DISEASES 144165 \| PRICKLE1 \| 3.901 \| DISEASES 57142 \| RTN4 \| 1.069 \| DISEASES 26278 \| SACS \| 1.945 \| DISEASES 6324 \| SCN1B \| 2.18 \| DISEASES
Locus	(Waiting for update.)

Disease ID	1652
Disease	epilepsy, progressive myoclonic 1a
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:6) HP:0001251 \| Ataxia HP:0002121 \| Petit mal seizures HP:0001268 \| Mental deterioration HP:0001260 \| Dysarthric speech HP:0002069 \| Generalized tonic clonic seizures HP:0001336 \| Myoclonic jerks
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:5) HP:0001336 \| Myoclonic jerks \| 6 HP:0001250 \| Seizures \| 2 HP:0001272 \| Cerebellar atrophy \| 1 HP:0040148 \| Cortical myoclonus \| 1 HP:0002120 \| Cerebral cortical atrophy \| 1

Disease ID	1652
Disease	epilepsy, progressive myoclonic 1a
Manually Symptom	(Waiting for update.)
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:1) C0235169 \| excitability \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:15)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs121909346	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774287	T	G
rs147484110	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774760	C	G
rs193922905	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	NA	NA	NA	NA	NA
rs312262707	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774640	CTGAGGCCCACACTCTAC	-
rs312262708	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774677	C	T
rs386833438	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	NA	NA	NA	NA	NA
rs386833439	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774701	G	T
rs386833440	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774658	C	T
rs386833441	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774332	T	C
rs386833443	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43776204	C	T
rs545986367	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774690	G	A
rs74315442	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774297	G	A
rs74315443	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43776260	C	G
rs796943858	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774280	GA	-
rs864309482	NA	1476	CSTB	umls:C0751785	CLINVAR	NA	0.570586233	NA	CSTB	21	43774637	CTCCTGAGGCCCACACTCTA	TT

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:2)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0002121	Absence seizures	MP:0009358	environmentally induced seizures	seizure activity response due to changes in ambient habitat including room temperature, lighting, sounds, touching, and/ or moving cage
HP:0002069	Generalized tonic-clonic seizures	MP:0003997	tonic-clonic seizures	increased number or decreased threshold for the induction of a seizure characterized by initial rigidity followed by rhythmic jerking movements

Mapped by homologous gene(Total Items:6)
HP ID	HP Name	MP ID	MP Name	Annotation
HP:0002069	Generalized tonic-clonic seizures	MP:0020301	short tongue	decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor
HP:0001268	Mental deterioration	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0002121	Absence seizures	MP:0020301	short tongue	decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor
HP:0001260	Dysarthria	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue
HP:0001251	Ataxia	MP:0020301	short tongue	decreased length of the mobile mass of muscular tissue and surrounding epithelial tissue occupying the cavity of the mouth and forming part of the floor
HP:0001336	Myoclonus	MP:0020329	decreased capillary density	reduction in the number of capillaries in a given cross-sectional area of a tissue

Disease ID	1652
Disease	epilepsy, progressive myoclonic 1a
Case	(Waiting for update.)

Web Analytics Made Easy - StatCounter